In addition, and showed expression patterns similar to the one observed and revealed inconsistent expression changes (Figure S2A). received by oral gavage sodium carboxymethyl cellulose (CMC solution) as vehicle control CD68 and the second group received a combination of vemurafenib (30 mg/kg) and selumetinib (15 mg/kg) diluted in CMC solution every 12 h for 36 or 60 h. For combinational treatment studies, two million A375P cells were resuspended in PBS, mixed with matrigel (60% PBS, 40% matrigel) and injected subcutaneously into the posterior flanks of BALB/cAnNRj-mice as described above. Mice were divided in groups of 8 when tumors reached 60 mm3. Four groups received by oral gavage either vehicle control BAY 73-6691 racemate alone or with 100 mg/kg dichloroacetate (DCA) or 32 mg/kg ETO or the combination of DCA and ETO. Four groups received by oral gavage either a combination of vemurafenib (24 mg/kg) and selumetinib (12 mg/kg) alone or with 100 mg/kg DCA or with 32 mg/kg ETO or the combination of DCA and ETO. Tumor formation was monitored every 3 days and tumor volume was calculated by the ellipsoidal formula (tumor volume = ? * (width2 * length). All protocols for animal use and experiments were approved by the Veterinary Office of Zurich (Switzerland). Glycolysis stress test and lactate measurements For the glycolysis stress test, melanoma cells treated with DMSO or the indicated inhibitors for 48 h were seeded in quintuplicates in a Seahorse XF Microplate. Cells were incubated overnight in a humidified 37 C incubator with 5% CO2. ECAR measurements were performed using the XF24 Extracellular Flux analyzer (Seahorse Bioscience). Prior to performing an assay, growth medium was exchanged with the appropriate unbuffered assay medium (Krebs-Henseleit buffer). 450 l of the assay medium containing the corresponding inhibitors were added to each well and the plate was incubated for 1 h at 37 C in a non-CO2 incubator. Each measurement cycle consisted of a mixing time of 3 minutes, a waiting time of 2 minutes and a data acquisition period of 2 minutes. ECAR data points refer to the average rates during the measurement cycles. All compounds were prepared at appropriate concentrations in assay medium and adjusted to pH 7.4. In a typical experiment, 3 baseline measurements were taken prior to the addition of 15 mM glucose, 3 measurements were taken prior the addition of 1 1 M oligomycin, 3 measurements were taken BAY 73-6691 racemate prior and after the addition of 200 mM 2-deoxy-D-glucose. ECAR was normalized to cell number in each experiment. Lactate concentrations were decided using the Cedex Bio Analyzer instrument (Roche Diagnostics) in cell-free supernatants of cells treated with MAPKi for 24 h. Values were normalized to integral of viable cells. Proliferation assay To determine the effects of ETO as single agent or in combination with DCA on cell proliferation, 10000 cells were seeded in 96-well plates and after attachment treated with DMSO, 1 M PLX alone or in combination with 0.5 M AZD. ETO, DCA or their combination were added at the indicated concentrations after 24 h. After 72 h cells were washed and incubated for 30 min at 37 C with PrestoBlue? Cell Viability Reagent (#A13262; ThermoFisher Scientific). The converted fluorescent dye was measured using the Infinite? M1000 PRO microplate reader (Tecan). Values were normalized to DMSO control. Compound synergy score was determined based on the BLISS model using Combenefit (24). CRISPR/Cas9 gene editing A375P cells were genetically engineered to generate knockout (KO) cells using the lentiCRISPRv2 plasmid (#52961; Addgene). Three sgRNAs for were designed using the ATUM gRNA Designer (https://www.atum.bio/eCommerce/cas9/input). sgRNA sequences used are: KO1: BAY 73-6691 racemate 5-(GTCTCTTTCCTGCAGCCCAA)NGG-3; KO2: 5-(GGAGGTATTCTAATGCCAGT)NGG-3; KO3: 5-(ACTTTGAGAGAACTGTTATG)NGG-3. Lentiviral particles were prepared by transiently transfecting HEK293T cells with lentiviral vectors together with packaging vectors (pMD2 and psPAX2) using the polyethylenimine transfection protocol. Supernatants were collected 48 h posttransfection, exceeded through a 0.45 m filter (BD Biosciences), and stored at ?80 C (25). For lentiviral transduction cells were seeded in 6 well-plates and infected with 0.5 ml lentiviral particles in 1.5 ml of complete medium. LentiCRISPRv2 without sgRNA was used as control. Infected cells were.